RPA Primer Design
Recombinase polymerase amplification primer design for isothermal CRISPR diagnostics.
Overview
Recombinase Polymerase Amplification (RPA) is an isothermal nucleic acid amplification method that operates at a constant temperature (37–42 °C), making it ideal for point-of-care CRISPR-based diagnostic assays. Unlike PCR, RPA does not require thermal cycling, enabling field-deployable detection systems.
SPACER includes an integrated RPA primer design module that generates forward and reverse primer pairs flanking the guide RNA target site. These primers are optimized for isothermal amplification performance and compatibility with downstream Cas12 or Cas13 detection.
Design Criteria
RPA primers have distinct design requirements compared to standard PCR primers. SPACER applies the following constraints during primer generation:
| Parameter | Range | Description |
|---|---|---|
| Primer length | 30–35 nt | Longer than PCR primers to support recombinase binding |
| GC content | 30–70% | Moderate GC for stable annealing at isothermal temperatures |
| Melting temperature | Informational | Reported but not used as a hard filter (RPA is isothermal) |
| Amplicon size | 100–300 bp | Short amplicons for rapid amplification |
| 3' end stability | Checked | Avoids 3' self-complementarity and hairpin formation |
| Dimer avoidance | Checked | Screens for primer-primer interactions |
Target Site Flanking
For each selected guide RNA, SPACER identifies the target binding site on the original input sequence and designs primers that flank this region. The forward primer binds upstream and the reverse primer binds downstream, producing an amplicon that contains the Cas detection site.
The primer placement ensures that the guide target site is centered within the amplicon when possible, providing optimal substrate geometry for Cas-mediated cleavage and signal generation.
Primer Scoring
Each primer pair receives a composite quality score based on:
- GC content within the optimal range
- Absence of long homopolymer runs (more than 5 consecutive identical bases)
- Low self-complementarity and hairpin potential
- Minimal primer-dimer formation between the forward and reverse primers
- Amplicon length within the preferred range for RPA
Output
The primer design results are displayed in the Primers tab of the analysis results page. Each primer pair shows:
| Field | Description |
|---|---|
| Forward sequence | 5' to 3' sequence of the forward primer |
| Reverse sequence | 5' to 3' sequence of the reverse primer |
| Amplicon length | Distance in base pairs between primer binding sites |
| GC content | Percentage for each primer individually |
| Quality score | Composite score reflecting overall primer pair quality |
Clustering Strategies
Before designing primers, SPACER groups nearby spacers into clusters so that a single primer pair can amplify multiple guide targets. Three clustering algorithms are available:
| Strategy | Algorithm | Best For |
|---|---|---|
| PositionBased | Left-to-right single-linkage sweep grouping spacers by genomic proximity. Exclusive membership — each spacer belongs to exactly one cluster. | Simple layouts with well-separated targets |
| ScorePriority | Highest-scoring spacers anchor clusters first, then lower-scoring neighbors fill in around them. Exclusive membership, score-aware seeding. | Ensuring top-ranked guides get dedicated primer pairs |
| MaximizeGoodCoverage (default) | Every spacer with assay score ≥ 0.60 seeds its own cluster. Clusters can overlap. Low-scoring spacers fall back to PositionBased clustering. | Maximizing primer coverage for high-quality guides |
All strategies respect max_distance_bp (maximum gap between spacers in a cluster) and max_cluster_span (maximum genomic footprint of a cluster).
T7 Promoter Prepend
In RpaT7 primer mode, a 25 nt canonical T7 promoter sequence (GAAATTAATACGACTCACTATAGGG) is prepended to the forward primer. This enables in vitro transcription (IVT) directly from the RPA amplicon — essential for SHERLOCK-style Cas13 diagnostic workflows where the amplified DNA must be converted to RNA for Cas13 detection.
Structure Filtering
After primer pair generation, SPACER screens candidates for problematic secondary structures using Primer3's ntthal thermodynamic engine. Three checks are performed on each primer pair:
| Check | What It Detects | Default Threshold |
|---|---|---|
| Hairpin | Self-folding of a single primer strand | ΔG ≤ −3.0 kcal/mol → reject |
| Homodimer | Self-hybridization between two copies of the same primer | ΔG ≤ −6.0 kcal/mol → reject |
| Heterodimer | Cross-hybridization between forward and reverse primers | ΔG ≤ −6.0 kcal/mol → reject |
Pairs that fail any check are excluded. When all candidates are rejected, SPACER reports diagnostic summaries showing the failure distribution and the best (least negative) ΔG values observed for each category.
Pre-filtering
For dense spacer sets — particularly Cas13 sequences where the sliding-window finder produces approximately 2× the sequence length in candidates — a pre-filter retains only the top N spacers by heuristic score before clustering. This prevents hundreds of redundant Primer3 calls. The Cas13 RPA preset uses max_primer_spacers = 500. For Cas12, pre-filtering is disabled by default since spacer density is naturally lower.
Fuzzy Deduplication
When using MaximizeGoodCoverage clustering, nearby seed spacers (e.g., positions 100, 101, 102 in a Cas13 sliding window) can each produce clusters with nearly identical region bounds. Fuzzy deduplication merges consecutive clusters whose region_start and region_end differ by at most region_merge_distance. The Cas13 RPA preset uses a merge distance of 15 bp. When disabled (Cas12 default), only exact-match deduplication is applied.