SPACER

GC Content Scoring

How SPACER evaluates the GC composition of candidate guide RNAs and applies penalty curves for extreme values.

Why GC Content Matters

GC content — the fraction of guanine (G) and cytosine (C) bases in a spacer — directly affects guide RNA thermodynamic stability and binding kinetics. G-C base pairs form three hydrogen bonds compared to two for A-T/A-U pairs, making GC-rich sequences bind more tightly.

  • Too low (<30%): Weak target binding, poor specificity, increased off-target activity
  • Too high (>70%): Overly stable secondary structures, reduced enzyme turnover, potential self-dimerization
  • Optimal (40–60%): Balanced binding affinity with minimal secondary structure complications

Calculation

GC content is calculated as a simple fraction of the spacer length:

text
GC% = (count_G + count_C) / spacer_length × 100

Example: AUGCCUAGGCUUAACGUUCA (20 nt)
  G count: 4, C count: 5
  GC% = 9/20 × 100 = 45%

Scoring Function

SPACER converts the raw GC percentage into a normalized score (0–1) using a trapezoidal penalty function. Guides within the ideal range receive a perfect score, with linear penalties applied as GC content deviates:

GC RangeScoreInterpretation
40–60%1.0Optimal — no penalty
30–40%0.5–1.0Slightly AT-rich — minor penalty
60–70%0.5–1.0Slightly GC-rich — minor penalty
<30%0.0–0.5Very AT-rich — significant penalty
>70%0.0–0.5Very GC-rich — significant penalty
<20% or >80%0.0Extreme — maximum penalty

The penalty curve is symmetric around the 40–60% ideal window. The linear slope in the penalty regions ensures that small deviations from the ideal range are penalized proportionally rather than as a hard cutoff.

Quality Flags

In addition to the continuous score, SPACER raises quality flags when GC content is particularly extreme:

FlagConditionMeaning
LOW_GCGC% < 30%Spacer is very AT-rich; binding may be weak
HIGH_GCGC% > 70%Spacer is very GC-rich; secondary structures likely
Info
GC content scoring is always active and applies equally to Cas12 and Cas13 guides. The ideal 40–60% range is consistent with published literature for both enzyme families.
Tip
If you are working with AT-rich organisms (e.g., Plasmodium) or GC-rich organisms (e.g., Streptomyces), consider adjusting the GC weight downward so that other scoring components have more influence on the final ranking.